PipMaker Home

PipMaker Instructions

Overview

PipMaker computes alignments of similar regions in two DNA sequences. The resulting alignments are summarized with a ``percent identity plot'', or ``pip'' for short.

To generate a pip, such as the one shown above, PipMaker requires four user-supplied files. The first sequence file is depicted along the horizontal axis. Interspersed repeats in the first sequence are indicated by various kinds of triangles, whose locations are supplied by a mask file of the first sequence. (The user generates this file using the RepeatMasker program, available on the web at the Institute for Systems Biology.) A file of gene and exon positions allows PipMaker to draw the locations of exons and indicate the directionality of genes, shown as black boxes and long arrows, respectively. Finally, the user provides a second sequence file. CpG islands in the first sequence are independently determined by PipMaker and are shown as low boxes.

PipMaker compares the first and second sequences. Alignments are plotted according to the position in the first sequence file. The light horizontal line through the middle of the plot indicates 75% nucleotide identity. This version of PipMaker compares the first sequence with both the second sequence and its reverse complement, so matching regions need not occur in the same orientations and relative positions in the two sequences. (Advanced PipMaker can optionally enforce the condition that matching regions appear in the same relative order and/or in the same orientation. To test PipMaker, copy the four provided files to your computer and submit them to PipMaker to generate the above sample pip.

Input to PipMaker

PipMaker processes the contents of the following four files. For each of those, you can either paste the data into the multi-line textarea or, if your browser supports it, give the filename in the subsequent single-line field.

First sequence data file. A FastA file containing the first sequence, with nucleotides given as capital letters. The maximum length is two million nucleotides. For example,
```
>exactly one header line, rest contain ACGT ONLY
ACGTACGTACGT
CGTACGTACGTA
GTACGTACGTAC
TACGTACGTACG
```
First sequence mask file. The documentation produced by RepeatMasker for the first sequence. (DO NOT include the masked sequence generated by RepeatMasker.) Thus, the sequence mask file contains entries like the following:
```
413 5.6 0.0 0.0 HUMAN 1 54 (92195) C Alu SINE/Alu (238) 62 9 SINE/Alu          (238)      62       9
```
In certain circumstances, RepeatMasker produces some summary statistics that precede lines of that form -- those additional lines are ignored by PipMaker. Inclusion of this file is optional, but it is strongly recommended for mammalian sequences, since otherwise biologically insignificant matches due to repeats will be computed. If this file is omitted, then the pip will not include icons showing the positions of interspersed repeat elements.
Exons file for the first sequence. An optional text file providing the positions of transcriptional units in the first sequence. The first line is displayed on the side of each page of the pip. Subsequent lines are used by PipMaker to draw the locations of genes. The directionality of a gene (< or >), its start and end positions, and name should be on one line, followed by separate lines specifying the start-positions and end-positions of each exon. (It is also permissible to begin the line with '|', in which case the line indicating the gene's position in the first sequence is drawn without an arrowhead.) An optional line beginning with a "+" character can indicate the first and last nucleotides of the translated region (including the initiation codon, Met, and the stop codon). Blank lines are ignored. Exons must be specified in order of increasing address even if the gene is on the reverse strand (<). Thus, the Exons file might begin as follows:
```
My favorite genomic region

> 100 800 Gene 1
100 200

300 400
600 800

< 1000 2000 Second Gene
+ 1100 1900
1000 1200
1800 2000
	...
```
If the exon numbers supplied by PipMaker are not adequate, a number (or a name, for that matter) can be specified at the end of exon-position lines.
Second sequence data file. A FastA file containing the second sequence. The maximum allowable length is 2Mb.

PipMaker Output

The following three files are returned as attachments to an email message. You will need a MIME-aware email program to read them.

The percent identity plot. This "pip" is a PDF document. If you don't have a PDF viewer to display the diagram, you can get Ghostscript here, or get Acroread from Adobe. At the present time, Acroread has better support for hyperlinks, which PipMaker uses. (Ghostview can also display PostScript. Advanced PipMaker can optionally generate PostScript instead of PDF.) Pips are described in more detail below.
A compressed form of the alignments. This information is useful for precisely identifying sequence positions corresponding to conserved regions indicated in the pip. There is a one-to-one correspondence between lines in this file and the small horizontal line segments in the pip (each of which corresponds to the region between successive gaps in a local alignment). For instance, suppose that after studying the pip at the top of this page, you become interested in the three blips around position 3k. In the compressed alignment file you will find something like:
```
	...
2870-2926 <--> 2281-2337 68% (57 nt)
3117-3128 <--> 2500-2511 83% (12 nt)
3129-3179 <--> 2513-2563 73% (51 nt)
	...
```
The first line asserts that positions 2870-2926 in the first sequence (57 basepairs) aligns to positions 2281-2337 of the second sequence, without gaps and at 68% identity.

The traditional textual form of the alignments. For example, the following alignment corresponds to the first line of the compressed form shown above.

      0     .    :    .    :    .    :    .    :    .    :
   2870 GCCCAGGCCTGGGCAGCGAGAGGGCCCTGCTCCCCGCTCAAGGCTCCCAG
        ||||||:| ||::||::|:|||| ||||||||:||:|||| ::|::::||
   2281 GCCCAGACATGAACAATGGGAGGCCCCTGCTCTCCACTCACAACCTTTAG

     50     .
   2920 GACATTC
        :||||||
   2331 AACATTC

Interpreting a Pip

The pip consists of rows that show sequence conservation and features along segments of the first sequence. Each short horizontal line inside the large box corresponds to a section of an alignment bounded by successive gaps (or an end of the alignment). For instance, suppose that one of the alignments computed for your two sequences begins as follows.

      0     .    :    .    :    .    :    .    :    .    :
  19163 GCGGCTCCATGTCACCTGCGGGCAAGGGGCTGGTGTGGAAAGCCCCACGG
        ||:||| || ::|||||||:||:: ||:-||| :::||||| |||||||
   6465 GCAGCTACAGACCACCTGCAGGTGTGGA CTGTCACGGAAACCCCCACGT

     50     .    :    .    :    .    :    .    :    .    :
  19213 CATGGTGGAAAGTCCGAAATTCTACAGGGGCCTCTTTGTTAAACCTC
         -||:||||||||||:||||||||||||:|:||:|:||||:| |::|---
   6514 G TGATGGAAAGTCCAAAATTCTACAGGAGTCTTTCTGTTGATCTCCAGT

	...

In this portion of the alignment, there are three gap-free pieces. The first covers positions 19163-19190 of the first sequence at 64% nucleotide identity, the second spans 19192-19213 at 68% identity, and the third covers 19215-19259 at 78% identity. This would be depicted in the pip by three horizontal line segments that indicate the positions in the first sequence and the percent identity.

Icons along the top of the box have the following meanings.

White pointed boxes are L1 repeats.
Light gray triangles are SINEs other than MIR.
Black triangles are MIRs.
Black pointed boxes are LINE2s.
Dark gray triangles and pointed boxes are other kinds of interspersed repeats, such as LTR elements and DNA transposons.
Short dark gray boxes are CpG islands where the ratio CpG/GpC exceeds 0.75.
Short white boxes are CpG islands where the ratio CpG/GpC lies between 0.6 and 0.75.

Error Messages

You should receive precisely one email message from PipMaker -- either your results or an error message. Error messages begin with lines indicating how far the computation proceeded, and should end with a line explaining the cause of the failure. Normally, the email message should be sent within a few minutes of your submission. However, it is possible that your email program might refuse to accept the message from PipMaker in cases where a huge amount of output is produced.