FastA format

Each sequence is uploaded as a file in FastA format, which looks like this:

>Sequence name and arbitrary text on one line
ACGTGCGCGATCGCCTGCTAGGCGTACGTCGCAG
GCGATCGATGTGCTAGATCAGATGACA
  ...

The sequence entries must be capital letters. (This requirement results from the way that interspersed repeats are masked, in which upper case letters are treated differently than lower case.)

At the present time, our software handles only the letters A, C, G, T, N, X.

For maximum interoperability, the sequence entries should consist of short lines, limited to about 70 characters.

The submission form has a text field for the full pathname of the file containing the sequence data on the local system (i.e. where the browser is running). Alternatively, pressing the "Browse..." button presents you with a file selection box. On either a PC or Mac, the sequence file needs to be saved as 'text only'.